A Fast and Simple, Non-Radioactive Assay to Replace EMSA in the Monitoring of DNA-Protein Interactions Julie Bédard1, Mathieu Larivière2, Daniel Sinnett2,3, Gregory Cosentino1 & Nathalie Rouleau1 Biotin-TEG-ATTCGATCGGGGCGGGGCGAG Sp1 Mutated ATTCGATCGGTTCGGGGCGAG Biotin-Sp1 Mutated Biotin-TEG-ATTCGATCGGTTCGGGGCGAG HNF1 Consensus TATTATGGTGAGCTAATAAGTTGCAAGTCCCT Biotin-HNF1 Consensus Biotin-TEG-TATTATGGTGAGCTAATAAGTTGCAAGTCCCT HNF1 Mutated TATTATGGTGAGCCAATAAGTTGCAAGTCCCT Biotin-HNF1 Mutated Biotin-TEG-TATTATGGTGAGCCAATAAGTTGCAAGTCCCT Non-Specific Competitor GATCGAACTGACCGCTTGCGGCCCGT B HNF1 400,000 Consensus Mutated 350,000 300,000 250,000 200,000 150,000 100,000 50,000 0 -9 -8 5,000 • • • • • • • • • • • • • • • • • Add 5 µL Assay Buffer (Standard Assay buffer was used for HNF1 experiments. For Sp1 studies, the standard buffer was supplemented with 3 µM ZnSO4) Add 5 µL Hep G2 Nuclear Extracts Add 5 µL biotinylated Oligos Incubate for 30 (Sp1) or 60 (HNF1) minutes at RT Add 5 µL of a pre-mix composed of the Ab with Protein A AlphaLISA® beads (20 µg/mL) for Sp1 or the Ab with Protein G AlphaLISA® beads (10 µg/mL) for HNF1 Incubate for 30 (Sp1) or 60 (HNF1) minutes at RT Add 5 µL SA-Donor beads (20 µg/mL for Sp1 or 40 µg/mL for HNF1) Incubate for 60 minutes at 23oC in the dark Read plate using an Alpha reader 60 180 200 120 700 Consensus Mutated 5,000 2,500 0 1200 A 2,000 1,000 0 -∞ -10 -9 -8 -7 log [Biotinylated Oligos] (M) B Sp1 S/B= 70.4 350,000 Consensus Mutated 300,000 250,000 200,000 150,000 100,000 50,000 0 -∞ -10 -9 -8 log [Ab] (M) -7 S/B= 6.4 6,000 Consensus Mutated 5,000 4,000 3,000 2,000 1,000 0 -11 -10 -9 700 1200 Detection incubation time (min) Consensus Mutated 400,000 S/B= 50.4 300,000 200,000 S/B 12.1 100,000 0 -7 -6 Consensus Mutated 8,000 7,000 4,000 3,000 2,000 0 -7 -6 -5 Assay Variability 300,000 250,000 X = 217185 200,000 CV = 7 % z'= 0,76 100,000 X = 7721 2 4 6 8 10 12 14 16 18 20 22 24 CV = 8 % Well number log [Ab] (M) B Consensus Mutated 1,400 1,200 X = 1222 1,000 CV = 7 % 800 z'= 0,54 600 400 X = 390 200 0 0 2 4 6 8 10 12 14 16 18 20 22 24 Non-specific -10 -9 -7 -8 log [Oligo] (M) 4,000 3,000 Oligonucleotide Consensus SP1 2,000 HNF1 1,000 + + + + + - +++++++ Mutated C Consensus Mutated Non-Specific + Consensus -6 HNF1 + Mutated IC50 value 2.3 nM 241,2 nM Non-specific 81,1 nM Consensus 121.6 nM Mutated N/A Non-specific N/A 0 -∞ -10 -9 -8 -7 -6 log [Oligo] (M) The assay specificity was demonstrated for (A) Sp1 and (B) HNF1. Untagged wild-type and non-specific DNA sequences were used as competitor for both assays. (C) A twolog difference in potency was observed between the consensus and non-specific sequences for Sp1 with IC50 values of 2.3 and 241 nM, respectively. For HNF1, no competitions occurred with non-specific oligonucleotides and a IC50 value of 122 nM was generated with the specific DNA sequence. Results generated from the (D) EMSA did not allow to demonstrate clearly the specificity of the HNF1 assay since partial competition was observed between mutated and consensus DNA sequences compared to a complete competition with the specific probe. Summary We have successfully demonstrated the application of a homogenous AlphaLISA® assay to replace EMSA in the monitoring of DNA-protein interaction from nuclear extract samples. • 1,000 Consenus Mutated 0 Mutated HNF1 Nuclear extracts 0 12 A lysate titration experiment was then conducted for both (A) Sp1 and (B) HNF1 detections using optimal assay conditions. As low as 1 µg/well of non-stimulated Hep G2 nuclear extracts permit the generation of S/B values of (A) 50.4 and (B) 2.6. However, wider assay window (6.4) for HNF1 assay could be generated by increasing the amount of lysate per well to 10 µg. 0 100,000 Consensus HNF1 Mutated S/B= 6.4 log [Lysates] (g/well) 50,000 200,000 -∞ S/B= 2.6 -∞ 150,000 Consensus 300,000 5,000 -5 A Labeled HNF1 6,000 log [Lysates] (g/well) -8 An antibody titration experiment was next performed using optimal oligonucleotide concentration; (A) Sp1 [1 µg nuclear extract/well] and (B) HNF1 [2 µg nuclear extract/well]. The greatest assay windows were obtained with 10 and 1 nM of antibody for (A) Sp1 and (B) HNF1 detections, respectively. HNF1 500,000 10 7,000 180 200 B -∞ HNF1 -∞ 120 Sp1 Antibody Titrations 7 60 Assay Sensitivity 3,000 400,000 B 0 A 4,000 -7 AlphaLISA Signal (counts) • Assay Buffer: 25 mM Hepes, 200 mM NaCl, 0.1% Tween-20 (pH7.4) Hep G2 nuclear extracts were prepared according to standard protocols2 for Sp1 experiments or sourced commercially for HNF1 experiments (Active Motif cat. no. 36011) Biotinylated and untagged oligonucleotides were synthesized and annealed to generate dsDNA oligonucleotides per standard protocols Anti-Sp1 Ab (sc-17824X) and anti-HNF1 Ab (sc-6547X) were from Santa Cruz Protein A- (cat. no. AL101) and Protein G(cat. no. AL102) conjugated-AlphaLISA® Acceptor beads were from PerkinElmer, Inc. Streptavidin (SA)-Donor beads (cat. no. 6760002) were from PerkinElmer, Inc. White opaque 384-well Optiplates (cat. no. 6007299) were from PerkinElmer, Inc. TopSeal-A (cat. no. 6005185) were from PerkinElmer, Inc. Incubator set at 23oC EnVision® reader was from PerkinElmer, Inc. Method AlphaLISA Signal (counts) • 0 Consensus Mutated 6,000 To determine its optimal concentration, an oligonucleotide titration curve was performed using fixed lysate concentration; (A) Sp1 [1 µg/well] and (B) HNF1 [2 µg/well]. Maximum response was observed using (A) 10 nM and (B) 30 nM of oligonucleotides, with signal to background ratio (S/B) value of 45.4 and 5.9, respectively. Detection of binding between DNA and transcription factor (TF) is done using Streptavidin-coated Donor beads that capture biotinylated DNA sequence while the TF is recognized by a specific anti-TF antibody which is captured by Protein A- or Protein G- conjugated AlphaLISA® Acceptor beads. Following protein - DNA binding, beads are brought into close proximity to produce an AlphaLISA signal. 4 100,000 9 Anti-transcription factor-conjugated AlphaLISA Acceptor Bead Materials 200,000 S/B=5.9 log [Biotinylated Oligos] (M) 3 Consensus Mutated S/B= 15.3 S/B= 6.2 7,500 AlphaLISA Signal (counts) Sp1 -∞ -10 Streptavidin-coated Alpha Donor Bead 300,000 AlphaLISA Signal (counts) A AlphaLISA Signal (counts) Tramscription factor 400,000 S/B= 7.4 A time course experiment was carried out on the detection step using optimized assay conditions; (A) Sp1 [1 µg nuclear extract/well] and (B) HNF1 [2 µg nuclear extract/well]. A final incubation of 60 minutes was chosen for further experiment assessments even though S/B value could be improved for Sp1 detection by incubating the reaction for a longer period of time. Biotinylated Oligonucleotide Titrations 6 AlphaLISA Signal (counts) Biotinylated oligonucleotide 500,000 10,000 Detection incubation time (min) S/B=45.4 Emission 615nm S/B= 25.4 0 Assay Configuration Excitation 680 nm 600,000 O/N S/B= 6.4 Hep G2 nuclear extracts Consensus Mutated Non-Specific Competitior probe Biotin-Sp1 Consensus O/N S/B= 22.2 HNF1 D Sp1 AlphaLISA Signal (counts) Sp1 Consensus B Sp1 Assay Specificity A AlphaLISA Signal (counts) Sequence (5’-3’) ATTCGATCGGGGCGGGGCGAG AlphaLISA Signal (counts) 2 Oligonucleotide 11 Detection Time Courses A AlphaLISA Signal (counts) The interaction of proteins with DNA is central to the control of many cellular processes including DNA replication, recombination and repair, transcription, and viral assembly. The benchmark technique used to study protein:DNA interactions is the electrophoretic mobility shift assay (EMSA). However, standard EMSA suffers from being a radioactive assay and is suitable only for low-throughput applications due to the requirement for a gel-based separation step to identify bound probes. This work describes development of a higher throughput non-radiometric assay to monitor the presence of specific DNAbinding proteins in nuclear extracts using a bead-based luminescent oxygen channeling immunoassay. As proof of concept, we used Hep G2 nuclear extracts to demonstrate binding of Sp1 and HNF1 transcription factors to tagged oligonucleotides containing required cognate response elements. Using as little as 1 µg of nuclear protein extract per well, with 10-30 nM of oligonucleotide, we achieved a specific signal to background ratio of 50.4 and 2.6 for Sp1 and HNF1, respectively. The HNF1 assay window could be increased more than two-fold (S/B of 6.5) by increasing the amount of lysate. Using the Sp1-specific assay, we measured a two-log difference in potency between the untagged wild-type oligonucleotide and corresponding mutated probe in a competition format. These results demonstrate that this novel non-radioactive DNA-binding assay could represent a powerful alternative to EMSA when higher throughput is desired. 8 Oligonucleotide Sequences AlphaLISA Signa (counts) 5 Introduction AlphaLISA Signal (counts) 1 Assay robustness was then demonstrated by generating Z’ value of (A) 0.76 and (B) 0.54 for Sp1 and HNF1 detections, respectively. The assay was performed using optimal assay conditions in the presence of (A) 1 µg/well and (B) 5 µg/well of Hep G2 nuclear extracts. •This novel AlphaLISA detection assay represents a major improvement over EMSA •Non-Radiometric Assay •Uses less DNA binding element •Easier and faster to execute •Greater throughput •No need for running a gel •Higher sensitivity •The robustness of both assays was demonstrated by generating Z’ value greater than 0.54. •Competition assays have: 1. Confirmed the specificity of the detection. 2. Demonstrated the advantage of using Alpha by using less binding element and at least two-fold less nuclear extracts than required to study interactions between TF and their respective DNA sequence with methods commonly used. CV = 11 % References: Well number 1PerkinElmer, 1 Vuori et al. FEBS J. (2009) ; 2 Schreiber et al. Nucleic Acids Res.. 17, 6419 (1989) Inc., 940 Winter Street, Waltham, MA USA (800) 762-4000 or (+1) 203 925-4602 www.perkinelmer.com 2 Centre de Recherche, CHU Sainte-Justine, Montréal, Qc, Canada 3Département de Pédiatrie, Université de Montréal, Montréal, Qc, Canada